What the hell. Dr. Fauci admits to the NY Times he's purposely misled us yet again about % needed to get to herd immunity

You’ve never criticized Trump or other Republican politicians or even posters on LR for downplaying the virus.

Allen53, Bad Wigins, Jamin, YMMV and several others start threads daily down playing the virus and not only do you say nothing, you actively allow them to use this platform to spread that misinformation.

duly noted wrote:

rojo wrote:

What I have never understood is how everyone loves Dr. Fauci - on both the left and right.

Wait, what. I’d say 99% of posts on this site that that say something about Fauci are negative towards him or a policy he supports. Granted most of those posts are probably the same person under numerous handles, but the shear quantity of negative posts is staggering. Not sure how the owner of this site could come to the conclusion above.

Exactly, the idea that left AND right all love Fauci is utter drivel. Rojo specializes in talking nonsense.

wejo wrote:

seattle prattle wrote:

Rojo, I believe you are making a mistake by taking a side in this debate. Owner's of the site should at least create the appearance of impartiality on controversial issues, like this.

In all due respect for you and your site, I will leave it at that, though i would ask you to reconsider posting such things.

From a PR standpoint using the words Fauci and lie is not a good idea but that's Rojo.

Expressing the idea that Robert did that he wished Fauci would tell the public what he truly believed instead of what he thought they wanted to hear should not be controversial. It's a perfectly reasonable belief.

But once Fauci and the word "lie" are put together it is going to bring controversy.

So we have what two examples of Fauci lying or misleading the public?

How many times have you or Rojo criticized Trumps lies or misleading information about Covid, or anything really?

Owner personal bias dominates this message board. There is no consistency.

No this and the response above are complete BS.

They are predicated on not understanding the last 50+ years of biology --at all--.

The virus has been isolated:

and several other works. You can see cryo-EM and ET images of it.

We have the full genome sequence.

We have RT-PCR protocols that identify RNA. We have tests that identify immune responses to the virus.

The only way to deny this is to continue to move the goalposts as to what "purified" is. Anyone with basic biological training understand these conditions have been met.

Only those intentionally trying to obfuscate and deny are arguing otherwise.

Stating "the virus doesn't exist" is absolute last-gasp denialism. It's hilarious.

P.S. The sequence 5' TTGGCAAAATTCAAGACTCACTTTC leads me to only conspiracy theory pages on google so I think you have a mistake in your primer there.

You think lying about it twice is bad, wait till you read about this joker Rojo.

From May 2020

Ok moreover the CDC primers were tested in silico (of course!) and no homologies were found with human genome or human microflora:

https://www.fda.gov/media/134922/download

Page 45.

It's just BS to claim otherwise.

You can see the primer sequences here yourself:

https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html

(Research use only but the same as the ones in the diagnostic kits under EUA)

Look you can ban whoever you want but there's a difference between denying the moon landing and

1) denying the existence of a virus during a very deadly pandemic

2) spamming the boards DAILY with crank theories intended in deceive and actively counter public health messaging important for virus mitigation

The amount of pure junk Allen53 and dunes (and others) post repeatedly washes out much of the scientifically accurate information on here. It's tiring to have to insist on the existence of the virus when we should be discussing things far more relevant. But no, every COVID thread has to deal with these dudes coming in screaming about the fake virus, the NWO, etc etc etc.

I try to report most of their threads but lots still slip through. These guys are as persistent as they are wrong.

What the hell? President Trump admits to journalist Bob Woodward he’s been lying to us all yet again about the seriousness of the coronavirus.

https://www.youtube.com/watch?v=bW5B_1OafO0

rojo has nailed it. I have never understood why anyone tolerates fauci - hes not even going to be a good fall guy.

This is the only clue you need.

When Fauci says something, and later says the first thing was a lie... the SECOND thing is the lie.

The first thing is the truth, and the second thing is whatever propels him along his trajectory of elderly-superstar. The guy is addicted to enjoying his fame before he dies of old age. He can no longer be held accountable for anything because he'll be 90 soon and any court will let him off on medical grounds, and then he'll die. Beware the end-of-life megalomaniac.

/thread

in my opinion wrote:

You’ve never criticized Trump or other Republican politicians or even posters on LR for downplaying the virus.

Allen53, Bad Wigins, Jamin, YMMV and several others start threads daily down playing the virus and not only do you say nothing, you actively allow them to use this platform to spread that misinformation.

This kind of behavior will get interesting when the law for online media will change. LR might be part of many lawsuits to come.

I was dumbfounded in March. I even played back the press conference to see if I had heard correctly. Fauci had said that masks were ineffective and worse than nothing. Then, in almost the next sentence, he said that we needed more PPEs (i.e., masks and other protective gear) for medical professionals. Worse, he said it over and over again in the next few days.

Also in March, the first promising comments about vitamin D appeared. (Source available.) In early April, the first study of vitamin D and COVID patients appeared. It was astounding. I waited for Dr. Fauci to recommend vitamin D. I'm still waiting. Sure, in a 42-minute interview back in September when DIRECTLY ASKED, he admitted to taking vitamin D, but he hasn't said anything public about it since then.

When that first vitamin D study appeared online, US deaths were less than 17,000. Yesterday, it was 325,000+. Could some of those deaths been prevented if Fauci had said, "We don't know for sure if it will help, but until we know, I suggest that everyone take vitamin D." I think so.

Clinical trials dot gov shows 67 (SIXTY-SEVEN!) clinical trials underway on vitamin D right now. Summit, the world's largest supercomputer, recommended vitamin D. Dozens of studies are now recommending vitamin D. Demographics hardest hit by COVID -- African Americans, seniors, the obese, diabetics, etc -- share a common characteristic... low vitamin D levels. Groups with naturally high levels of vitamin D -- native Swedes -- tend to have a low incidence of COVID 19.

As far as Fauci is concerned, I quit listening to the little weasel when he lied over and over about face masks.

In my mind, this is what I heard him saying over and over back in March and April.

/sarc Masks are ineffective and worse than not wearing a mask, but when a medical professional wears a mask THE MAGIC HAPPENS and they work so we desperately need more PPEs. /sarc

I wouldn't buy a used car from this guy. He may be right or wrong on herd immunity... I give no weight whatsoever to his opinion.

Greta Tunaberg wrote:

in my opinion wrote:

You’ve never criticized Trump or other Republican politicians or even posters on LR for downplaying the virus.

Allen53, Bad Wigins, Jamin, YMMV and several others start threads daily down playing the virus and not only do you say nothing, you actively allow them to use this platform to spread that misinformation.

This kind of behavior will get interesting when the law for online media will change. LR might be part of many lawsuits to come.

Yeah, that doesn’t surprise me that you leftists want to shut down free speech. The lame stream media and big tech already censor anything not conforming to the leftist propaganda line.

What a dangerous bunch of mindless phonies. And from the same folks who peddled the Russian collusion hoax for 3 years.

Dementia Joe is not my president. Resist!

10/10

Well conceived trolling, rojo. Already 100+ responses.

[quote]Bad Wigins wrote:

This is the only clue you need.

When Fauci says something, and later says the first thing was a lie... the SECOND thing is the lie.

Exactly.

[quote]the media is corrupt wrote:

What a dangerous bunch of mindless phonies. And from the same folks who peddled the Russian collusion hoax for 3 years.

You mean for 4 years -- and still ongoing.

The Russians did it.

Ignore what we have been caught doing...it's Putin.

I hope Fauci chokes

The Unkle wrote:

[quote]the media is corrupt wrote:

What a dangerous bunch of mindless phonies. And from the same folks who peddled the Russian collusion hoax for 3 years.

You mean for 4 years -- and still ongoing.

The Russians did it.

Ignore what we have been caught doing...it's Putin.

Science in general is in a real crisis. It's been generally politicized and corrupted by big money globalists so bad that most of it is not worthy of trust.

And the worst part is the fact that millions of ordinary people will try to silence all scientific debate, in defense of one scientific argument that happens to be politically beneficial.

Harambe reports post that make him cry? Haha what a simp.